Быстрый заказ

Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PROCR Информация о продукте «Клон cDNA»
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein C receptor, endothelial (EPCR) with C terminal Flag tag.
Синоним гена:CCCA, EPCR, CCD41, CD201, bA42O4.2, PROCR
Участок рестрикции:HindIII + NotI (6kb + 0.77kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PROCR Gene Plasmid Map
Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human PROCR Gene Expression validated Image
Human PROCR ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13320-ACGRBS15400
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13320-ACRRBS15400
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13320-CFRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13320-CHRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13320-CMRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13320-CYRBS13340
Человек Epcr/PROCR Джин клон кДНК в вектор клонированияHG13320-GRBS5130
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13320-NFRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13320-NHRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13320-NMRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13320-NYRBS13340
Человек Epcr/PROCR Джин ORF экспрессии кДНК клона плазмидыHG13320-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.
  • Size / Price
    Каталог: HG13320-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human PROCR ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.