Быстрый заказ

Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRNP Информация о продукте «Клон cDNA»
Размер кДНК:762bp
Описание кДНК:Full length Clone DNA of Homo sapiens prion protein with C terminal HA tag.
Синоним гена:CD230, PRP
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12070-ACGRBS15400
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12070-ACRRBS15400
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12070-CFRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12070-CHRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12070-CMRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12070-CYRBS13340
Человек PRNP / Prion Белок Джин клон кДНК в вектор клонированияHG12070-GRBS5130
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12070-NFRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12070-NHRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12070-NMRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12070-NYRBS13340
Человек PRNP / Prion Белок Джин ORF экспрессии кДНК клона плазмидыHG12070-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.