Быстрый заказ

Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PRKCQ Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_006257.3
    Размер кДНК:2121bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase C, theta with N terminal His tag.
    Синоним гена:PRKCT, nPKC-theta
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRKCQ qPCR primers for gene expression analysis, HP100174 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10091-ACGRBS16760
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10091-ACRRBS16760
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10091-ANGRBS16760
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10091-ANRRBS16760
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10091-CFRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10091-CHRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10091-CMRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10091-CYRBS14710
    Человек GLRX3/PRKCT Джин клон кДНК в вектор клонированияHG10091-GRBS5130
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмидыHG10091-M-NRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10091-NFRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10091-NHRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10091-NMRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10091-NYRBS14710
    Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмидыHG10091-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10091-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».