After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKCQ Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006257.3
Размер кДНК:2121bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase C, theta with N terminal His tag.
Синоним гена:PRKCT, nPKC-theta
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10091-ACGRBS16764
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10091-ACRRBS16760
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10091-ANGRBS16764
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10091-ANRRBS16760
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10091-CFRBS14710
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10091-CHRBS14710
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10091-CMRBS14710
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10091-CYRBS14710
Человек GLRX3/PRKCT Джин клон кДНК в вектор клонированияHG10091-GRBS5130
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмидыHG10091-M-NRBS14711
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10091-NFRBS14710
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10091-NHRBS14711
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10091-NMRBS14711
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10091-NYRBS14710
Человек GLRX3/PRKCT Джин ORF экспрессии кДНК клона плазмидыHG10091-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10091-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».