Быстрый заказ

Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKCG Информация о продукте «Клон cDNA»
Размер кДНК:2094bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase C, gamma with N terminal Flag tag.
Синоним гена:PKCC, PKCG, SCA14, MGC57564, PKC-gamma
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11242-ACGRBS16760
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11242-ACRRBS16760
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11242-ANGRBS16760
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11242-ANRRBS16760
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11242-CFRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11242-CHRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11242-CMRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11242-CYRBS14710
Человек PRKCG/PKCG Джин клон кДНК в вектор клонированияHG11242-MRBS5130
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11242-M-FRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11242-NFRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11242-NHRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11242-NMRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11242-NYRBS14710
Человек PRKCG/PKCG Джин ORF экспрессии кДНК клона плазмидыHG11242-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11242-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.