Быстрый заказ

Text Size:AAA

Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKCB Информация о продукте «Клон cDNA»
Размер кДНК:2022bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase C, beta with N terminal His tag.
Синоним гена:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10750-ACGRBS16760
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10750-ACRRBS16760
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10750-ANGRBS16760
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10750-ANRRBS16760
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10750-CFRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10750-CHRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10750-CMRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10750-CYRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10750-NFRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10750-NHRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10750-NMRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10750-NYRBS14710
Человек PRKCB Джин клон кДНК в вектор клонированияHG10750-URBS5130
Человек PRKCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10750-U-FRBS14710
Человек PRKCB Джин ORF экспрессии кДНК клона плазмидыHG10750-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10750-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.