PRKAR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14416-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PRKAR1A Reagents

CRO Services

Product recommended


All PRKAR1A Reagents

PRKAR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1146 bp
Description
Full length Clone DNA of Human protein kinase, cAMP-dependent, regulatory, type I, alpha with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKAR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

ACRDYS1 cDNA ORF Clone, Human;ADOHR cDNA ORF Clone, Human;CAR cDNA ORF Clone, Human;CNC cDNA ORF Clone, Human;CNC1 cDNA ORF Clone, Human;PKR1 cDNA ORF Clone, Human;PPNAD1 cDNA ORF Clone, Human;PRKAR1 cDNA ORF Clone, Human;TSE1 cDNA ORF Clone, Human

PRKAR1A Background Information

PRKAR1A, also known as PRKAR1 and PKR1, is one of the regulatory subunits of cAMP-dependent protein kinase A (PKA). PKA can be activated by cAMP. cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating PKA, which transduces the signal throughphosphorylation of different target proteins. The inactive holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits of PKA have been identified in humans. PRKAR1A was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids Three alternatively spliced transcript variants encoding the same protein have been observed.

Full Name
protein kinase, cAMP-dependent, regulatory, type I, alpha
References
  • Huang L J. et al., 1997, Proc Natl Acad Sci. 94 (21): 11184-9.
  • Herberg F W. et al., 2000, J Mol Biol. 298 (2): 329-39.
  • Scambler P. et al., 1987, Am J Hum Genet. 41 (5): 925-32.
  • PRKAR1A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PRKAR1A cDNA ORF Clone in Cloning Vector, Rat RG83148-U
    PRKAR1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83148-ACGLN

    PRKAR1A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PRKAR1A cDNA ORF Clone in Cloning Vector, Mouse MG51743-G
    PRKAR1A cDNA ORF Clone, Mouse, untagged MG51743-UT
    PRKAR1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51743-ACG
    PRKAR1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51743-ACGLN
    PRKAR1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51743-ANG
    PRKAR1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51743-ACR
    PRKAR1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51743-ANR
    PRKAR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51743-CF
    PRKAR1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51743-NF
    PRKAR1A cDNA ORF Clone, Mouse, C-His tag MG51743-CH
    PRKAR1A cDNA ORF Clone, Mouse, N-His tag MG51743-NH
    PRKAR1A cDNA ORF Clone, Mouse, C-HA tag MG51743-CY
    PRKAR1A cDNA ORF Clone, Mouse, N-HA tag MG51743-NY
    PRKAR1A cDNA ORF Clone, Mouse, C-Myc tag MG51743-CM
    PRKAR1A cDNA ORF Clone, Mouse, N-Myc tag MG51743-NM
    PRKAR1A qPCR Primer Pairs, Mouse MP201616

    PRKAR1A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PRKAR1A cDNA ORF Clone in Cloning Vector, Human HG14416-G
    PRKAR1A cDNA ORF Clone, Human, untagged HG14416-UT
    PRKAR1A cDNA ORF Clone, Human, C-GFPSpark® tag HG14416-ACG
    PRKAR1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14416-ACGLN
    PRKAR1A cDNA ORF Clone, Human, N-GFPSpark® tag HG14416-ANG
    PRKAR1A cDNA ORF Clone, Human, C-OFPSpark® tag HG14416-ACR
    PRKAR1A cDNA ORF Clone, Human, N-OFPSpark® tag HG14416-ANR
    PRKAR1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14416-CF
    PRKAR1A cDNA ORF Clone, Human, C-His tag HG14416-CH
    PRKAR1A cDNA ORF Clone, Human, N-His tag HG14416-NH
    PRKAR1A cDNA ORF Clone, Human, C-HA tag HG14416-CY
    PRKAR1A cDNA ORF Clone, Human, N-HA tag HG14416-NY
    PRKAR1A cDNA ORF Clone, Human, C-Myc tag HG14416-CM
    PRKAR1A cDNA ORF Clone, Human, N-Myc tag HG14416-NM
    PRKAR1A qPCR Primer Pairs, Human HP103065
    info info
    添加购物车成功! 添加购物车失败!