After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKAB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005399
Размер кДНК:819bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase, AMP-activated, beta 2 non-catalytic subunit.
Синоним гена:MGC61468, PRKAB2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PRKAB2
Участок рестрикции:KpnI + XbaI (6.1kb + 0.82kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PRKAB2 Gene Plasmid Map
Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12032-ACGRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12032-ACRRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12032-ANGRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12032-ANRRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12032-CFRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12032-CHRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12032-CMRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12032-CYRBS13340
Человек PRKAB2 Джин клон кДНК в вектор клонированияHG12032-GRBS5130
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12032-NFRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12032-NHRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12032-NMRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12032-NYRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмидыHG12032-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12032-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».