Быстрый заказ

Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKAB2 Информация о продукте «Клон cDNA»
Размер кДНК:819bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase, AMP-activated, beta 2 non-catalytic subunit with C terminal His tag.
Синоним гена:MGC61468, PRKAB2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12032-ACGRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12032-ACRRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12032-ANGRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12032-ANRRBS15400
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12032-CFRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12032-CHRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12032-CMRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12032-CYRBS13340
Человек PRKAB2 Джин клон кДНК в вектор клонированияHG12032-GRBS5130
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12032-NFRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12032-NHRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12032-NMRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12032-NYRBS13340
Человек PRKAB2 Джин ORF экспрессии кДНК клона плазмидыHG12032-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12032-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.