PRICKLE2 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

PRICKLE2 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2535 bp
Description
Full length Clone DNA of Human prickle homolog 2 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRICKLE2 cDNA ORF Clone, Human, N-His tag: Alternative Names

EPM5 cDNA ORF Clone, Human

PRICKLE2 Background Information

PRICKLE2 gene was mapped to human chromosome 3p14. Prickle2 (Pk2) is a post-synaptic non-canonical Wnt signaling protein shown to interact with post-synaptic density 95 (PSD-95). Disruptions in non-canonical Wnt genes such as PRICKLE2 may contribute to synaptic abnormalities underlying ASDs.
Full Name
prickle homolog 2 (Drosophila)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait