After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRICKLE2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC119002
Размер кДНК:2535bp
Описание кДНК:Full length Clone DNA of Homo sapiens prickle homolog 2 (Drosophila) with N terminal His tag.
Синоним гена:EPM5
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15965-ACGRBS22240
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15965-ACRRBS22240
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15965-ANGRBS22240
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15965-ANRRBS22240
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15965-CFRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15965-CHRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15965-CMRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15965-CYRBS20190
Человек PRICKLE2 Джин клон кДНК в вектор клонированияHG15965-GRBS5130
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15965-NFRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15965-NHRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15965-NMRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15965-NYRBS20190
Человек PRICKLE2 Джин ORF экспрессии кДНК клона плазмидыHG15965-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15965-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».