Быстрый заказ

Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PREP Информация о продукте «Клон cDNA»
Размер кДНК:2133bp
Описание кДНК:Full length Clone DNA of Homo sapiens prolyl endopeptidase with C terminal Flag tag.
Синоним гена:PE, PEP, MGC16060
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10987-ACGRBS16760
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10987-ACRRBS16760
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10987-ANGRBS16760
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10987-ANRRBS16760
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10987-CFRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10987-CHRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10987-CMRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10987-CYRBS14710
Человек Prolyl endopeptidase / PREP Джин клон кДНК в вектор клонированияHG10987-MRBS5130
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10987-NFRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10987-NHRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10987-NMRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10987-NYRBS14710
Человек Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмидыHG10987-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Каталог: HG10987-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.