PRELP cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

PRELP cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Human proline/arginine-rich end leucine-rich repeat prot with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRELP cDNA ORF Clone, Human, C-Myc tag: Alternative Names

MST161 cDNA ORF Clone, Human; MSTP161 cDNA ORF Clone, Human; SLRR2A cDNA ORF Clone, Human

PRELP Background Information

PRELP (proline/arginine-rich end leucine-rich repeat protein) is a member of the leucine-rich repeat (LRR) family of extracellular matrix proteins in connective tissue. In contrast with other members of the family, the N-terminal domain of PRELP has a high content of proline and positively charged amino acids. This domain has previously been shown to bind chondrocytes and to inhibit osteoclast differentiation.PRELP is a 58-kDa proteoglycan found in a variety of extracellular matrices, including cartilage and at several basement membranes.
Full Name
proline/arginine-rich end leucine-rich repeat protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait