Быстрый заказ

Text Size:AAA

Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRELP Информация о продукте «Клон cDNA»
Размер кДНК:1149bp
Описание кДНК:Full length Clone DNA of Homo sapiens proline/arginine-rich end leucine-rich repeat prot with C terminal Myc tag.
Синоним гена:MST161;SLRR2A;MSTP161;PRELP
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13538-ACGRBS15396
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13538-ACRRBS15396
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13538-CFRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13538-CHRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13538-CMRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13538-CYRBS13343
Human PRELP Gene cDNA clone plasmidHG13538-GRBS3620
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13538-NFRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13538-NHRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13538-NMRBS13343
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13538-NYRBS13343
Человек PRELP/Prolargin Джин клон кДНК в вектор клонированияHG13538-URBS5132
Человек PRELP/Prolargin Джин ORF экспрессии кДНК клона плазмидыHG13538-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13538-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.