After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRDX1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007063.1
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
Синоним гена:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PRDX1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.6kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11194-ACGRBS15400
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11194-ACRRBS15400
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11194-ANGRBS15400
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11194-ANRRBS15400
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11194-CFRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11194-CHRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11194-CMRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11194-CYRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин клон кДНК в вектор клонированияHG11194-MRBS5130
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11194-M-FRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11194-NFRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11194-NHRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11194-NMRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11194-NYRBS13340
Человек Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмидыHG11194-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Ссылки
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Каталог: HG11194-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».