After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC003138
Размер кДНК:1863bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein regulator of cytokinesis 1.
Синоним гена:ASE1, PRC1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13280-ACGRBS16760
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13280-ACRRBS16760
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13280-ANGRBS16760
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13280-ANRRBS16760
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13280-CFRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13280-CHRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13280-CMRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13280-CYRBS14710
Человек PRC1 Джин клон кДНК в вектор клонированияHG13280-GRBS5130
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13280-NFRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13280-NHRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13280-NMRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13280-NYRBS14710
Человек PRC1 Джин ORF экспрессии кДНК клона плазмидыHG13280-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis. It interacts with KIF14, IF20A and PLK1.

Ссылки
  • Jiang W, et al. (1999) PRC1: a human mitotic spindle-associated CDK substrate protein required for cytokinesis. Mol Cell. 2(6):877-85.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):173-8.
  • Mollinari C, et al. (2002) PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol. 15 (7):1175-86.
  • Size / Price
    Каталог: HG13280-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».