Быстрый заказ

Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PPP3R1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000945.3
    Размер кДНК:513bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protein phosphatase 3, regulatory subunit B, alpha with N terminal His tag.
    Синоним гена:CNB, CNB1, CALNB1, PPP3R1
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PPP3R1 qPCR primers for gene expression analysis, HP102352 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13673-ACGRBS15400
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13673-ACRRBS15400
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13673-ANGRBS15400
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13673-ANRRBS15400
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13673-CFRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13673-CHRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13673-CMRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13673-CYRBS13340
    Человек PPP3R1 Джин клон кДНК в вектор клонированияHG13673-GRBS5130
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13673-NFRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13673-NHRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13673-NMRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13673-NYRBS13340
    Человек PPP3R1 Джин ORF экспрессии кДНК клона плазмидыHG13673-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.

    Ссылки
  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • Size / Price
    Каталог: HG13673-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».