Быстрый заказ

Text Size:AAA

Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PPP3CA Информация о продукте «Клон cDNA»
Размер кДНК:1536bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with N terminal His tag.
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13669-ACGRBS16764
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13669-ACRRBS16764
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13669-ANGRBS16764
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13669-ANRRBS16764
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13669-CFRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13669-CHRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13669-CMRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13669-CYRBS14711
Человек PPP3CA transcript variant 2 Джин клон кДНК в вектор клонированияHG13669-GRBS5132
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13669-NFRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13669-NHRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13669-NMRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13669-NYRBS14711
Человек PPP3CA transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG13669-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • Size / Price
    Каталог: HG13669-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.