Быстрый заказ

Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PPP3CA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000944.4
Размер кДНК:1566bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1 with N terminal His tag.
Синоним гена:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13670-ACGRBS16760
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13670-ACRRBS16760
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13670-ANGRBS16760
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13670-ANRRBS16760
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13670-CFRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13670-CHRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13670-CMRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13670-CYRBS14710
Человек PPP3CA transcript variant 1 Джин клон кДНК в вектор клонированияHG13670-GRBS5130
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13670-NFRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13670-NHRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13670-NMRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13670-NYRBS14710
Человек PPP3CA transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG13670-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

Ссылки
  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».