Быстрый заказ

Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Human PPM1G natural ORF mammalian expression plasmid, N-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек PPM1G Информация о продукте «Клон cDNA»
Размер кДНК:1641bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent, 1G with N terminal Flag tag.
Синоним гена:PP2CG, PPP2CG, MGC1675, MGC2870, PP2CGAMMA, PPM1G
Участок рестрикции:KpnI + XbaI (6kb + 1.69kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with PPM1G qPCR primers for gene expression analysis, HP101189 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PPM1G Gene Plasmid Map
Human PPM1G natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11245-ACGRBS16760
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11245-ACRRBS16760
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11245-ANGRBS16760
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11245-ANRRBS16760
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11245-CFRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11245-CHRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11245-CMRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11245-CYRBS14710
Человек PPM1G Джин клон кДНК в вектор клонированияHG11245-MRBS5130
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11245-NFRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11245-NHRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11245-NMRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11245-NYRBS14710
Человек PPM1G Джин ORF экспрессии кДНК клона плазмидыHG11245-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.
  • Size / Price
    Каталог: HG11245-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.