PPIL3 cDNA ORF Clone, Human, untagged

Cat: HG14929-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PPIL3 Reagents

CRO Services

Product recommended


All PPIL3 Reagents

PPIL3 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase (cyclophilin)-like 3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPIL3 cDNA ORF Clone, Human, untagged Alternative Names

CYPJ cDNA ORF Clone, Human

PPIL3 Background Information

Full Name
peptidylprolyl isomerase (cyclophilin)-like 3

PPIL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPIL3 cDNA ORF Clone in Cloning Vector, Mouse MG53794-U
PPIL3 cDNA ORF Clone, Mouse, untagged MG53794-UT
PPIL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53794-ACGLN
PPIL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53794-ACG
PPIL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53794-ANG
PPIL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53794-ACR
PPIL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53794-ANR
PPIL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53794-CF
PPIL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53794-NF
PPIL3 cDNA ORF Clone, Mouse, C-His tag MG53794-CH
PPIL3 cDNA ORF Clone, Mouse, N-His tag MG53794-NH
PPIL3 cDNA ORF Clone, Mouse, C-HA tag MG53794-CY
PPIL3 cDNA ORF Clone, Mouse, N-HA tag MG53794-NY
PPIL3 cDNA ORF Clone, Mouse, C-Myc tag MG53794-CM
PPIL3 cDNA ORF Clone, Mouse, N-Myc tag MG53794-NM

PPIL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPIL3 cDNA ORF Clone in Cloning Vector, Human HG14929-G
PPIL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14929-ACG
PPIL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14929-ACGLN
PPIL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14929-ANG
PPIL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14929-ACR
PPIL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14929-ANR
PPIL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14929-CF
PPIL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14929-NF
PPIL3 cDNA ORF Clone, Human, C-His tag HG14929-CH
PPIL3 cDNA ORF Clone, Human, N-His tag HG14929-NH
PPIL3 cDNA ORF Clone, Human, C-HA tag HG14929-CY
PPIL3 cDNA ORF Clone, Human, N-HA tag HG14929-NY
PPIL3 cDNA ORF Clone, Human, C-Myc tag HG14929-CM
PPIL3 cDNA ORF Clone, Human, N-Myc tag HG14929-NM
PPIL3 qPCR Primer Pairs, Human HP103558
info info
添加购物车成功! 添加购物车失败!