PPIE cDNA ORF Clone, Human, untagged

Cat: HG14791-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PPIE Reagents

CRO Services

Product recommended


All PPIE Reagents

PPIE cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase E (cyclophilin E).

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPIE cDNA ORF Clone, Human, untagged Alternative Names

CYP-33 cDNA ORF Clone, Human;CYP33 cDNA ORF Clone, Human

PPIE Background Information

Full Name
peptidylprolyl isomerase E (cyclophilin E)

PPIE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPIE cDNA ORF Clone in Cloning Vector, Mouse MG53919-U
PPIE cDNA ORF Clone, Mouse, untagged MG53919-UT
PPIE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53919-ACGLN
PPIE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53919-ACG
PPIE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53919-ANG
PPIE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53919-ACR
PPIE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53919-ANR
PPIE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53919-CF
PPIE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53919-NF
PPIE cDNA ORF Clone, Mouse, C-His tag MG53919-CH
PPIE cDNA ORF Clone, Mouse, N-His tag MG53919-NH
PPIE cDNA ORF Clone, Mouse, C-HA tag MG53919-CY
PPIE cDNA ORF Clone, Mouse, N-HA tag MG53919-NY
PPIE cDNA ORF Clone, Mouse, C-Myc tag MG53919-CM
PPIE cDNA ORF Clone, Mouse, N-Myc tag MG53919-NM

PPIE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPIE cDNA ORF Clone in Cloning Vector, Human HG14791-G
PPIE cDNA ORF Clone, Human, C-GFPSpark® tag HG14791-ACG
PPIE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14791-ACGLN
PPIE cDNA ORF Clone, Human, N-GFPSpark® tag HG14791-ANG
PPIE cDNA ORF Clone, Human, C-OFPSpark® tag HG14791-ACR
PPIE cDNA ORF Clone, Human, N-OFPSpark® tag HG14791-ANR
PPIE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14791-CF
PPIE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14791-NF
PPIE cDNA ORF Clone, Human, C-His tag HG14791-CH
PPIE cDNA ORF Clone, Human, N-His tag HG14791-NH
PPIE cDNA ORF Clone, Human, C-HA tag HG14791-CY
PPIE cDNA ORF Clone, Human, N-HA tag HG14791-NY
PPIE cDNA ORF Clone, Human, C-Myc tag HG14791-CM
PPIE cDNA ORF Clone, Human, N-Myc tag HG14791-NM
PPIE qPCR Primer Pairs, Human HP103424
info info
添加购物车成功! 添加购物车失败!