Быстрый заказ

Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PPARGC1A Информация о продукте «Клон cDNA»
Размер кДНК:2397bp
Описание кДНК:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma, coactivator 1 alpha with N terminal HA tag.
Синоним гена:LEM6, PGC1, PGC1A, PGC-1v, PPARGC1, PGC-1(alpha), PPARGC1A
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12107-ACGRBS16760
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12107-ACRRBS16760
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12107-ANGRBS16760
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12107-ANRRBS16760
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12107-CFRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12107-CHRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12107-CMRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12107-CYRBS14710
Человек PPARGC1A/PGC1 Джин клон кДНК в вектор клонированияHG12107-GRBS5130
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12107-NFRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12107-NHRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12107-NMRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12107-NYRBS14710
Человек PPARGC1A/PGC1 Джин ORF экспрессии кДНК клона плазмидыHG12107-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12107-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.