Быстрый заказ

Text Size:AAA

Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PPARA Информация о продукте «Клон cDNA»
Размер кДНК:1407bp
Описание кДНК:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor alpha with C terminal HA tag.
Синоним гена:hPPAR, NR1C1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12080-ACGRBS15400
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12080-ACRRBS15400
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12080-ANGRBS15400
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12080-ANRRBS15400
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12080-CFRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12080-CHRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12080-CMRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12080-CYRBS13340
Человек PPARA Джин клон кДНК в вектор клонированияHG12080-GRBS5130
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12080-NFRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12080-NHRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12080-NMRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12080-NYRBS13340
Человек PPARA Джин ORF экспрессии кДНК клона плазмидыHG12080-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12080-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.