Быстрый заказ

Text Size:AAA

Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human POMGNT1 Информация о продукте «Клон cDNA»
Размер кДНК:1983bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase with N terminal Myc tag.
Синоним гена:RP11-322N21.3, DKFZp761B182, FLJ20277, GNTI.2, GnT I.2, MDDGA3, MDDGB3, MDDGC3, MEB, MGAT1.2, gnT-I.2, POMGNT1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14301-ACGRBS16760
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14301-ACRRBS16760
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14301-CFRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14301-CHRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14301-CMRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14301-CYRBS14710
Человек POMGNT1 Джин клон кДНК в вектор клонированияHG14301-GRBS5130
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14301-NFRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14301-NHRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14301-NMRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14301-NYRBS14710
Человек POMGNT1 Джин ORF экспрессии кДНК клона плазмидыHG14301-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14301-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.