After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PNLIPRP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005989
Размер кДНК:1410bp
Описание кДНК:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 2 with N terminal His tag.
Синоним гена:PLRP2
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13687-ACGRBS15400
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13687-ACRRBS15400
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13687-CFRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13687-CHRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13687-CMRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13687-CYRBS13340
Человек Galactolipase / PNLIPRP2 Джин клон кДНК в вектор клонированияHG13687-GRBS5130
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13687-NFRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13687-NHRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13687-NMRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13687-NYRBS13340
Человек Galactolipase / PNLIPRP2 Джин ORF экспрессии кДНК клона плазмидыHG13687-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.

Ссылки
  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • Size / Price
    Каталог: HG13687-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».