Быстрый заказ

Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PMVK Информация о продукте «Клон cDNA»
    Размер кДНК:579bp
    Описание кДНК:Full length Clone DNA of Homo sapiens phosphomevalonate kinase with N terminal Flag tag.
    Синоним гена:PMK, PMKA, PMKASE, HUMPMKI
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with PMVK qPCR primers for gene expression analysis, HP103218 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14583-ACGRBS15400
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14583-ACRRBS15400
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14583-ANGRBS15400
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14583-ANRRBS15400
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14583-CFRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14583-CHRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14583-CMRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14583-CYRBS13340
    Человек PMVK / phosphomevalonate kinase Джин клон кДНК в вектор клонированияHG14583-GRBS5130
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14583-NFRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14583-NHRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14583-NMRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14583-NYRBS13340
    Человек PMVK / phosphomevalonate kinase Джин ORF экспрессии кДНК клона плазмидыHG14583-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    PMVK is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of PMVK is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis.

    Size / Price
    Каталог: HG14583-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.