After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PMM2 Информация о продукте «Клон cDNA»
Размер кДНК:741bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
Синоним гена:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14648-ACGRBS15400
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14648-ACRRBS15400
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14648-ANGRBS15400
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14648-ANRRBS15400
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14648-CFRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14648-CHRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14648-CMRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14648-CYRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин клон кДНК в вектор клонированияHG14648-GRBS5130
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14648-NFRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14648-NHRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14648-NMRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14648-NYRBS13340
Человек phosphomannomutase 2 / PMM2 / CDG1 Джин ORF экспрессии кДНК клона плазмидыHG14648-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.