After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLTP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006227.2
Размер кДНК:1482bp
Описание кДНК:Full length Clone DNA of Homo sapiens phospholipid transfer protein, transcript variant 1 with N terminal HA tag.
Синоним гена:HDLCQ9, PLTP
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11171-ACGRBS15400
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11171-ACRRBS15400
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11171-CFRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11171-CHRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11171-CMRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11171-CYRBS13340
Человек PLTP transcript variant 1 Джин клон кДНК в вектор клонированияHG11171-MRBS5130
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11171-M-FRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11171-NFRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11171-NHRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11171-NMRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11171-NYRBS13340
Человек PLTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11171-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Phospholipid transfer protein, also known as Lipid transfer protein II and PLTP, is a secreted protein which belongs to the BPI/LBP/Plunc superfamily and BPI / LBP family. PLTP is nearly ubiquitously expressed in cells and tissues. PLTP converts HDL into larger and smaller particles. It may play a key role in extracellular phospholipid transport and modulation of hdl particles. High-density lipoproteins (HDL) play a major protective role against the development of coronary artery disease. PLTP is a main factor regulating the size and composition of HDL in the circulation and plays an important role in controlling plasma HDL levels. This is achieved via both the phospholipid transfer activity of PLTP and its capability to cause HDL conversion. PLTP is one of the key lipid transfer proteins in plasma and cerebrospinal fluid. It is involved in novel intracellular functions. PLTP is an important modulator of lipoprotein metabolism, including interparticle phospholipid transfer, remodeling of HDL, cholesterol and phospholipid efflux from peripheral tissues, and the production of hepatic VLDL. PLTP also plays an important role in inflammation and oxidative stress. Accordingly, PLTP has also been implicated in the development of atherosclerosis.

Ссылки
  • Huuskonen, J. et al., 2000, Atherosclerosis. 151 (2): 451-61.
  • Huuskonen,J. et al., 2001, Atherosclerosis. 155 (2): 269-81.
  • Valenta,D.T. et al., 2008, J Lipid Res. 49 (1): 24-32.
  • Vuletic,S. et al., 2009, Biochim Biophys Acta. 1793 (3): 584-91.
  • Chen, X. et al., 2009, Nutr Metab. 6 : 49.
  • Size / Price
    Каталог: HG11171-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».