PLK4 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PLK4 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2913 bp
Description
Full length Clone DNA of Human polo-like kinase 4 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PLK4 cDNA ORF Clone, Human, untagged: Alternative Names

MCCRP2 cDNA ORF Clone, Human; SAK cDNA ORF Clone, Human; STK18 cDNA ORF Clone, Human

PLK4 Background Information

Polo like kinase-4 (PLK4) is one such kinase that appears in low abundance and plays a well-characterized role in centriole duplication.Polo-like kinases (PLK) are eukaryotic regulators of cell cycle progression, mitosis and cytokinesis; PLK4 is a master regulator of centriole duplication. The localization of PLK4 on centrioles must be precisely regulated during mitosis to ensure correct centriole duplication. PLK4 deregulation (i.e. both overexpression and depletion of PLK4), leads to altered mitotic fidelity and thereby triggers tumorigenesis. PLK4 is the major kinase driving centriole duplication. Duplication occurs only once per cell cycle, forming one new (or daughter) centriole that is tightly engaged to the preexisting (or mother) centriole.
Full Name
polo like kinase 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait