After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLK4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014264.4
Размер кДНК:2913bp
Описание кДНК:Full length Clone DNA of Homo sapiens polo-like kinase 4 (Drosophila).
Синоним гена:SAK, STK18, PLK4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10659-ACGRBS22240
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10659-ACRRBS22240
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10659-ANGRBS22240
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10659-ANRRBS22240
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10659-CFRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10659-CHRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10659-CMRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10659-CYRBS20190
Человек PLK4/SAK Джин клон кДНК в вектор клонированияHG10659-MRBS5130
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10659-NFRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10659-NHRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10659-NMRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10659-NYRBS20190
Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмидыHG10659-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10659-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».