Быстрый заказ

Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PLK4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_014264.4
    Размер кДНК:2913bp
    Описание кДНК:Full length Clone DNA of Homo sapiens polo-like kinase 4 (Drosophila).
    Синоним гена:SAK, STK18, PLK4
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLK4 qPCR primers for gene expression analysis, HP100628 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10659-ACGRBS22240
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10659-ACRRBS22240
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10659-ANGRBS22240
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10659-ANRRBS22240
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10659-CFRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10659-CHRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10659-CMRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10659-CYRBS20190
    Человек PLK4/SAK Джин клон кДНК в вектор клонированияHG10659-MRBS5130
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10659-NFRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10659-NHRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10659-NMRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10659-NYRBS20190
    Человек PLK4/SAK Джин ORF экспрессии кДНК клона плазмидыHG10659-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10659-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».