Быстрый заказ

Text Size:AAA

Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLK3 Информация о продукте «Клон cDNA»
Размер кДНК:1941bp
Описание кДНК:Full length Clone DNA of Homo sapiens polo-like kinase 3 (Drosophila) with N terminal Myc tag.
Синоним гена:CNK, FNK, PRK, PLK3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11454-ACGRBS16760
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11454-ACRRBS16760
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11454-CFRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11454-CHRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11454-CMRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11454-CYRBS14710
Человек PLK3 Gene cDNA clone plasmidHG11454-MRBS5130
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11454-M-FRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмидыHG11454-M-NRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11454-NFRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11454-NHRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11454-NMRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11454-NYRBS14710
Человек PLK3 Джин ORF экспрессии кДНК клона плазмидыHG11454-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11454-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.