Быстрый заказ

Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек PLK2 Информация о продукте «Клон cDNA»
Размер кДНК:2058bp
Описание кДНК:Full length Clone DNA of Homo sapiens polo-like kinase 2 (Drosophila) with N terminal His tag.
Синоним гена:SNK, PLK2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with PLK2 qPCR primers for gene expression analysis, HP101256 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11374-ACGRBS16760
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11374-ACRRBS16760
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11374-ANGRBS16760
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11374-ANRRBS16760
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11374-CFRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11374-CHRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11374-CMRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11374-CYRBS14710
Человек PLK2 Джин клон кДНК в вектор клонированияHG11374-MRBS5130
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11374-NFRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11374-NHRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11374-NMRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11374-NYRBS14710
Человек PLK2 Джин ORF экспрессии кДНК клона плазмидыHG11374-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11374-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.