After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005030.3
Размер кДНК:1812bp
Описание кДНК:Full length Clone DNA of Homo sapiens polo-like kinase 1 (Drosophila).
Синоним гена:PLK, STPK13, PLK1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PLK1
Участок рестрикции:HindIII + XbaI (6.1kb + 1.81kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PLK1 Gene Plasmid Map
Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10676-ACGRBS16760
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10676-ACRRBS16760
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10676-ANGRBS16760
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10676-ANRRBS16760
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10676-CFRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10676-CHRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10676-CMRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10676-CYRBS14710
Человек PLK1/PLK-1 Джин клон кДНК в вектор клонированияHG10676-MRBS5130
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10676-M-FRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10676-NFRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10676-NHRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10676-NMRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10676-NYRBS14710
Человек PLK1/PLK-1 Джин ORF экспрессии кДНК клона плазмидыHG10676-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

Ссылки
  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • Size / Price
    Каталог: HG10676-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».