After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLBD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_173542.3
Размер кДНК:1770bp
Описание кДНК:Full length Clone DNA of Homo sapiens phospholipase B domain containing 2 with C terminal Flag tag.
Синоним гена:P76
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13947-ACGRBS16760
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13947-ACRRBS16760
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13947-CFRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13947-CHRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13947-CMRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13947-CYRBS14710
Человек PLBD2 Джин клон кДНК в вектор клонированияHG13947-GRBS5130
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13947-G-HRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13947-NFRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13947-NHRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13947-NMRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13947-NYRBS14710
Человек PLBD2 Джин ORF экспрессии кДНК клона плазмидыHG13947-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PLBD2 localizes to the lysosome, as its absence could plausibly lead to a serious yet unrecognized lysosomal storage disease. PLBD1 and PLBD2 are semi-orphans in the sense of being probable phospholipases of B class but with uncertain physiological substrates and thus functionalities. PLBD1 and PLBD2 constitute a small gene family (sequence homology class) within vertebrates though one that occurs expanded in some early diverging eukaryotes. PLBD2 presents a special difficulty in that a sequence of post-translational steps are apparently necessary for its activation. Without these, potential substrates can hardly be assayed. These steps include removal of the signal peptide, mannosylation appropriate to the lysosome targeting receptor, and self-catalytic proteolytic activation to expose the substrate binding site as this becomes appropriate.

Ссылки
  • Morgan CP. et al., 2004), Biochem J. 382 (2): 441-9.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012. Cell. 150 (5): 1068-81.
  • Size / Price
    Каталог: HG13947-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».