Быстрый заказ

Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PLAC9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001012973.1
    Размер кДНК:294bp
    Описание кДНК:Full length Clone DNA of Homo sapiens placenta-specific 9 with N terminal Flag tag.
    Синоним гена:PLAC9
    Виды:Human
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLAC9 qPCR primers for gene expression analysis, HP102628 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13971-ACGRBS15400
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13971-ACRRBS15400
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13971-CFRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13971-CHRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13971-CMRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13971-CYRBS13340
    Человек PLAC9 / placenta-specific 9 Джин клон кДНК в вектор клонированияHG13971-GRBS5130
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13971-NFRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13971-NHRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13971-NMRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13971-NYRBS13340
    Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмидыHG13971-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

    Ссылки
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».