Быстрый заказ

Text Size:AAA

Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLAC9 Информация о продукте «Клон cDNA»
Размер кДНК:294bp
Описание кДНК:Full length Clone DNA of Homo sapiens placenta-specific 9 with N terminal Flag tag.
Синоним гена:PLAC9
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13971-ACGRBS15400
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13971-ACRRBS15400
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13971-CFRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13971-CHRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13971-CMRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13971-CYRBS13340
Человек PLAC9 / placenta-specific 9 Джин клон кДНК в вектор клонированияHG13971-GRBS5130
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13971-NFRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13971-NHRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13971-NMRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13971-NYRBS13340
Человек PLAC9 / placenta-specific 9 Джин ORF экспрессии кДНК клона плазмидыHG13971-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Каталог: HG13971-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.