Быстрый заказ

Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PLA2G4F Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_213600.3
    Размер кДНК:2550bp
    Описание кДНК:Full length Clone DNA of Homo sapiens phospholipase A2, group IVF with N terminal His tag.
    Синоним гена:PLA2G4FZ, PLA2G4F
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLA2G4F qPCR primers for gene expression analysis, HP102350 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13671-ACGRBS22240
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13671-ACRRBS22240
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13671-ANGRBS22240
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13671-ANRRBS22240
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13671-CFRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13671-CHRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13671-CMRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13671-CYRBS20190
    Человек PLA2G4F Джин клон кДНК в вектор клонированияHG13671-GRBS5130
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13671-NFRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13671-NHRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13671-NMRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13671-NYRBS20190
    Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмидыHG13671-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13671-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».