Быстрый заказ

Text Size:AAA

Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLA2G4F Информация о продукте «Клон cDNA»
Размер кДНК:2550bp
Описание кДНК:Full length Clone DNA of Homo sapiens phospholipase A2, group IVF with N terminal His tag.
Синоним гена:PLA2G4FZ, PLA2G4F
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13671-ACGRBS22240
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13671-ACRRBS22240
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13671-ANGRBS22240
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13671-ANRRBS22240
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13671-CFRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13671-CHRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13671-CMRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13671-CYRBS20190
Человек PLA2G4F Джин клон кДНК в вектор клонированияHG13671-GRBS5130
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13671-NFRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13671-NHRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13671-NMRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13671-NYRBS20190
Человек PLA2G4F Джин ORF экспрессии кДНК клона плазмидыHG13671-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13671-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.