After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLA2G2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000300.2
Размер кДНК:435bp
Описание кДНК:Full length Clone DNA of Homo sapiens phospholipase A2, group IIA (platelets, synovial fluid).
Синоним гена:MOM1, PLA2, PLA2B, PLA2L, PLA2S, PLAS1, sPLA2, PLA2G2A
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PLA2G2A
Участок рестрикции:KpnI + XbaI (6.1kb + 0.44kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 96 G/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PLA2G2A Gene Plasmid Map
Human PLA2G2A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11187-ACGRBS15400
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11187-ACRRBS15400
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11187-CFRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11187-CHRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11187-CMRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11187-CYRBS13340
Человек PLA2G2A Джин клон кДНК в вектор клонированияHG11187-MRBS5130
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11187-M-FRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11187-NFRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11187-NHRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11187-NMRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11187-NYRBS13340
Человек PLA2G2A Джин ORF экспрессии кДНК клона плазмидыHG11187-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

Ссылки
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • Size / Price
    Каталог: HG11187-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PLA2G2A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».