Быстрый заказ

Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PKP2 Информация о продукте «Клон cDNA»
Размер кДНК:2514bp
Описание кДНК:Full length Clone DNA of Homo sapiens plakophilin 2 with N terminal Flag tag.
Синоним гена:ARVD9
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15708-ACGRBS22240
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15708-ACRRBS22240
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15708-ANGRBS22240
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15708-ANRRBS22240
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15708-CFRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15708-CHRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15708-CMRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15708-CYRBS20190
Человек PKP2 Джин клон кДНК в вектор клонированияHG15708-GRBS5130
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15708-NFRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15708-NHRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15708-NMRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15708-NYRBS20190
Человек PKP2 Джин ORF экспрессии кДНК клона плазмидыHG15708-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15708-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.