PKM2 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

PKM2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pyruvate kinase, muscle with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 1.65kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PKM2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PKM2 cDNA ORF Clone, Human, N-Myc tag: Validated Images

PKM2 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CTHBP cDNA ORF Clone, Human; HEL-S-30 cDNA ORF Clone, Human; OIP3 cDNA ORF Clone, Human; PK3 cDNA ORF Clone, Human; PKM2 cDNA ORF Clone, Human; TCB cDNA ORF Clone, Human; THBP1 cDNA ORF Clone, Human

PKM2 Background Information

Pyruvate kinase isozymes M2 also known as pyruvate kinase muscle isozyme 2 (PKM2), pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1), or opa-interacting protein 3 (OIP3), is an isoenzyme of the glycolytic enzyme pyruvate kinase. Pyruvate kinase isozymes M2 / PKM2 is a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. PKM2 has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. PKM2 has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. PKM2 functions as a glycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. PKM2 may stimulates POU5F1-mediated transcriptional activation. This protein Plays a general role in caspase independent cell death of tumor cells. The ratio betwween the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms of PKM2 contributes to the control of glycolysis and is important for tumor cell proliferation and survival.
Full Name
pyruvate kinase, muscle
References
  • Bluemlein K, et al. (2011) No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2 (5): 393-400.
  • Gupta V, et al. (2010) Dominant Negative Mutations Affect Oligomerization of Human Pyruvate Kinase M2 Isozyme and Promote Cellular Growth and Polyploidy. J Biol Chem. 285 (22): 16864-73.
  • Eigenbrodt E, et al. (1992) Double role for pyruvate kinase type M2 in the expansion of phosphometabolite pools found in tumor cells. Crit Rev Oncog. 3 (1): 91-115.

PKM2 cDNA ORF Clone, Human, Related Products

PKM2 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed