After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRKD3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005813.3
Размер кДНК:2673bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein kinase D3.
Синоним гена:EPK2, PKD3, PRKCN, PKC-NU, nPKC-NU, PRKD3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10665-ACGRBS22240
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10665-ACRRBS22240
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10665-ANGRBS22240
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10665-ANRRBS22240
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10665-CFRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10665-CHRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10665-CMRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10665-CYRBS20190
Человек PKC-nu/PRKD3 Джин клон кДНК в вектор клонированияHG10665-MRBS5130
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмидыHG10665-M-NRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10665-NFRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10665-NHRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10665-NMRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10665-NYRBS20190
Человек PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмидыHG10665-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

Ссылки
  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    Каталог: HG10665-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».