Быстрый заказ

Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PITPNB Информация о продукте «Клон cDNA»
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphatidylinositol transfer protein, beta with N terminal HA tag.
Синоним гена:VIB1B, PtdInsTP, PI-TP-beta, PITPNB
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14050-ACGRBS15400
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14050-ACRRBS15400
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14050-ANGRBS15400
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14050-ANRRBS15400
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14050-CFRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14050-CHRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14050-CMRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14050-CYRBS13340
Человек PITPNB Джин клон кДНК в вектор клонированияHG14050-GRBS5130
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14050-NFRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14050-NHRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14050-NMRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14050-NYRBS13340
Человек PITPNB Джин ORF экспрессии кДНК клона плазмидыHG14050-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14050-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.