After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PIP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PIP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010950
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Homo sapiens prolactin-induced protein.
Синоним гена:GPIP4, GCDFP15, GCDFP-15, PIP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PIP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13297-ACGRBS15400
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13297-ACRRBS15400
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13297-CFRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13297-CHRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13297-CMRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13297-CYRBS13340
Человек PIP Джин клон кДНК в вектор клонированияHG13297-GRBS5130
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13297-NFRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13297-NHRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13297-NMRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13297-NYRBS13340
Человек PIP Джин ORF экспрессии кДНК клона плазмидыHG13297-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13297-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».