Быстрый заказ

Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PILRB Информация о продукте «Клон cDNA»
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Homo sapiens paired immunoglobin-like type 2 receptor beta with N terminal Myc tag.
Синоним гена:hCG_2024112, FDFACT1, FDFACT2, PILRB
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13746-ACGRBS15400
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13746-ACRRBS15400
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13746-CFRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13746-CHRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13746-CMRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13746-CYRBS13340
Человек PILRB Джин клон кДНК в вектор клонированияHG13746-GRBS5130
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13746-NFRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13746-NHRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13746-NMRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13746-NYRBS13340
Человек PILRB Джин ORF экспрессии кДНК клона плазмидыHG13746-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Wilson MD, et al. (2006) Comparative analysis of the paired immunoglobulin-like receptor (PILR) locus in six mammalian genomes: duplication, conversion, and the birth of new genes. Physiol Genomics. 27 (3): 201-18.
  • Orr MT, et al. (2010) Natural killer cell education and tolerance. Cell. 142(6): 847-56.
  • Mousseau DD, et al. (2000) PILRalpha, a novel immunoreceptor tyrosine-based inhibitory motif-bearing protein, recruits SHP-1 upon tyrosine phosphorylation and is paired with the truncated counterpart PILRbeta. J Biol Chem. 275 (6): 4467-74.
  • Size / Price
    Каталог: HG13746-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.