Быстрый заказ

Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PILRB Информация о продукте «Клон cDNA»
    Размер кДНК:684bp
    Описание кДНК:Full length Clone DNA of Homo sapiens paired immunoglobin-like type 2 receptor beta with N terminal Myc tag.
    Синоним гена:hCG_2024112, FDFACT1, FDFACT2, PILRB
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with PILRB qPCR primers for gene expression analysis, HP102423 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13746-ACGRBS15400
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13746-ACRRBS15400
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13746-CFRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13746-CHRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13746-CMRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13746-CYRBS13340
    Человек PILRB Джин клон кДНК в вектор клонированияHG13746-GRBS5130
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13746-NFRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13746-NHRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13746-NMRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13746-NYRBS13340
    Человек PILRB Джин ORF экспрессии кДНК клона плазмидыHG13746-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
  • Wilson MD, et al. (2006) Comparative analysis of the paired immunoglobulin-like receptor (PILR) locus in six mammalian genomes: duplication, conversion, and the birth of new genes. Physiol Genomics. 27 (3): 201-18.
  • Orr MT, et al. (2010) Natural killer cell education and tolerance. Cell. 142(6): 847-56.
  • Mousseau DD, et al. (2000) PILRalpha, a novel immunoreceptor tyrosine-based inhibitory motif-bearing protein, recruits SHP-1 upon tyrosine phosphorylation and is paired with the truncated counterpart PILRbeta. J Biol Chem. 275 (6): 4467-74.
  • Size / Price
    Каталог: HG13746-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.