After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PIAS1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC121797
Размер кДНК:1956bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein inhibitor of activated STAT, 1 with N terminal His tag.
Синоним гена:GBP, ZMIZ3, DDXBP1, GU/RH-II
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15957-ACGRBS16760
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15957-ACRRBS16760
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15957-ANGRBS16760
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15957-ANRRBS16760
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15957-CFRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15957-CHRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15957-CMRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15957-CYRBS14710
Человек PIAS1 Джин клон кДНК в вектор клонированияHG15957-GRBS5130
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15957-NFRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15957-NHRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15957-NMRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15957-NYRBS14710
Человек PIAS1 Джин ORF экспрессии кДНК клона плазмидыHG15957-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15957-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».