Быстрый заказ

Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PI3 Информация о продукте «Клон cDNA»
Размер кДНК:354bp
Описание кДНК:Full length Clone DNA of Homo sapiens peptidase inhibitor 3, skin-derived with C terminal Myc tag.
Синоним гена:ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12187-ACGRBS15400
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12187-ACRRBS15400
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12187-CFRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12187-CHRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12187-CMRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12187-CYRBS13340
Человек PI3/Elafin/WFDC14 Джин клон кДНК в вектор клонированияHG12187-GRBS5130
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12187-NFRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12187-NHRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12187-NMRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12187-NYRBS13340
Человек PI3/Elafin/WFDC14 Джин ORF экспрессии кДНК клона плазмидыHG12187-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.

Size / Price
Каталог: HG12187-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.