AGXT2L2 cDNA ORF Clone, Human, N-OFPSpark® tag

Price:
Size:
Number:

AGXT2L2 cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Human 5-phosphohydroxy-L-lysine phospho-lyase with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About AGXT2L2

Entrez Gene ID

AGXT2L2 cDNA ORF Clone, Human, N-OFPSpark® tag: Alternative Names

AGXT2L2 cDNA ORF Clone, Human; PHLU cDNA ORF Clone, Human

AGXT2L2 Background Information

Full Name
5-phosphohydroxy-L-lysine phospho-lyase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait