Быстрый заказ

Text Size:AAA

Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PHYH Информация о продукте «Клон cDNA»
Размер кДНК:1017bp
Описание кДНК:Full length Clone DNA of Homo sapiens phytanoyl-CoA 2-hydroxylase with N terminal Flag tag.
Синоним гена:RD, LN1, PAHX, LNAP1, PHYH1, PHYH
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13368-ACGRBS15400
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13368-ACRRBS15400
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13368-ANGRBS15400
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13368-ANRRBS15400
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13368-CFRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13368-CHRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13368-CMRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13368-CYRBS13340
Человек PHYH Джин клон кДНК в вектор клонированияHG13368-GRBS5130
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13368-NFRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13368-NHRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13368-NMRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13368-NYRBS13340
Человек PHYH Джин ORF экспрессии кДНК клона плазмидыHG13368-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.