Быстрый заказ

Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PHPT1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_014172.5
    Размер кДНК:378bp
    Описание кДНК:Full length Clone DNA of Homo sapiens phosphohistidine phosphatase 1 with C terminal HA tag.
    Синоним гена:PHPT1
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PHPT1 qPCR primers for gene expression analysis, HP104802 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16380-ACGRBS15400
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16380-ACRRBS15400
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16380-ANGRBS15400
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16380-ANRRBS15400
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16380-CFRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16380-CHRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16380-CMRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16380-CYRBS13340
    Человек PHPT1 Джин клон кДНК в вектор клонированияHG16380-GRBS5130
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16380-NFRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16380-NHRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16380-NMRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16380-NYRBS13340
    Человек PHPT1 Джин ORF экспрессии кДНК клона плазмидыHG16380-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.

    Ссылки
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • Size / Price
    Каталог: HG16380-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».