After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGM3 Информация о продукте «Клон cDNA»
Размер кДНК:1629bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphoglucomutase 3 with N terminal His tag.
Синоним гена:AGM1, PAGM, PGM 3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14852-ACGRBS16760
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14852-ACRRBS16760
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14852-ANGRBS16760
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14852-ANRRBS16760
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14852-CFRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14852-CHRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14852-CMRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14852-CYRBS14710
Человек PGM3/phosphoglucomutase 3 Джин клон кДНК в вектор клонированияHG14852-GRBS5130
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14852-NFRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14852-NHRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14852-NMRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14852-NYRBS14710
Человек PGM3/phosphoglucomutase 3 Джин ORF экспрессии кДНК клона плазмидыHG14852-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14852-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.