After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC038843
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 2 with C terminal HA tag.
Синоним гена:PGKB, PGKPS, dJ417L20.2
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15178-ACGRBS15396
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15178-ACRRBS15396
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15178-ANGRBS15396
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15178-ANRRBS15396
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15178-CFRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15178-CHRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15178-CMRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15178-CYRBS13343
Человек PGK2 Джин клон кДНК в вектор клонированияHG15178-GRBS5132
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15178-NFRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15178-NHRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15178-NMRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15178-NYRBS13343
Человек PGK2 Джин ORF экспрессии кДНК клона плазмидыHG15178-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15178-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».